[X] My Assistant

Fuck Q:

This image matched the specified keywords.
(IMG:[gannonman.com] http://gannonman.com/image/momoe_aoi_04_org02_164544276.jpg)

This image matched the specified keywords.
(IMG:[gannonman.com] http://gannonman.com/image/momoe_aoi_04_org02_164544276.jpg)

man i wish i was there i think futa sex is hot

This post has been edited by mr daniels: Jan 11 2010, 23:59

Flint needs red numbers up his assburger.

https://e-hentai.org/dmspublic/karma.php?u=92344&k=n

(IMG:[invalid] style_emoticons/default/happy.gif)

Oh, you again *smooooooch*

LOL?

(IMG:[gannonman.com] http://gannonman.com/image/tohato12_942530764.jpg)

And now my jaunty install is practically unusable...

LOL

+6 Garbage on 2010-01-14 06:45 by starboar
Details: This shit is even to extreme for 4chans /d/ and is bannable. One day some poor shit who visited E-Hentai from some anal country, is going to be sitting in court on a bullshit obscenity charge, and the prosecutor will bring up the fact he visited a site th

+1 Garbage on 2010-01-14 05:31 by 1c3d1c3
Details: disgusting

+6 Duplicate on 2010-01-14 00:35 by Deris
Details: Murdering children?

+1 Illicit on 2010-01-13 23:18 by NonGawd
Details: gore

+6 Illicit on 2010-01-13 19:36 by xD4N73x
Details: Gore

This post has been edited by 3d0xp0xy: Jan 14 2010, 11:14

I'm willing to bet those are the same people who go around expunging the lolicon galleries for being "pedoshit".

Seriously though, those images really aren't that bad.

This post has been edited by Rob Itagaki: Jan 14 2010, 11:19

1 and 20 are the same image.

2010-01-17 00:08 -637 radixius 20429 You're too kind.

You have a real hard on for me, even though I've been away for several months.

Do you have no life? Are you wanting to troll that much to get attention for yourself?

I feel sad for people like you. Only picking on those who can't try to defend themselves and laugh at them because of your ego.

Well, if that's what you want, then I shall respond.


To anyone one out there, if you want to raise others up to squash bugs like this, then give K+. Give K to me, give some to a friend, give a little all around.

Never give some to this guy.

Let the K+ begin!

This post has been edited by DennoCoil: Jan 17 2010, 03:02

You have a real hard on for me, even though I've been away for several months.

Do you have no life? Are you wanting to troll that much to get attention for yourself?

Nah, it was because of this:

2010-01-16 23:07 -?? Anonymous 20429

What was the old saying? Kindness begets kindness? If someone can think of a clever antithesis to that, go ahead.

But I think some forms of negativity may, in fact, be the most considerate things.

This, however, does not mean I do not have a hard on for you. You, whom I have never met, never conversed with, seen, heard, smelled or touched.

We'll instead chalk it up to serendipity.

2010-01-16 23:07 -?? Anonymous 20429

Really? You're basing your assumption that I've wronged you on that? How the hell do you even know that was me?

Because your bar was half empty when I saw you replied to the thread, you were the only person in the thread at the time and it had just happened.

Would it have gotten into your head that I have imbued others with Karma?

Oh, and the two question marks are also an egregious clue.

Almost like a fingerprint.

Then why the fuck would you have such a rage fit over 50K?

Because I needed something fun to happen. This place is boring when you're not around.

Also, in your post up there:

How the hell do you even know that was me?

That was basically your brain using words to indicate you had done it. Honestly, it was an inkling before that, but when I saw your unintended confession, it just screamed at me.

I mean, unless you didn't, there's an easy test: Pop me with some non-anonymous negative karma, and that's all we need to know for sure.

To anyone one out there, if you want to raise others up to squash bugs like this, then give K+. Give K to me, give some to a friend, give a little all around.

Never give some to this guy.

Let the K+ begin!

Your faggocity is awe inspiring.

Quick, we must elope, have genetically spliced children, rapidly age them to 18-ish, get them accounts here, and, hopefully, if D.D.D.'s Nonsensical Superpost gene takes:

CODE

(GCTAGAGACTATCTACTGTGTAGCTAGCTTGTTTGGGAAACAGAGGTAGACAGATAGCACCCAGATACCTTCTCTTGTGATCGCTCTGATCGTCTGGCGCGCGATTATATCGATCTGACTGACTGACTGAGCT)

We can carpet bomb DennoCoil with negative karma like a motherfucker.

Because that shit matters COLONROLLEYESCOLON

I'mma get right on that, sir.